NEET 2024 Zoology Question 164 Solution

DNA-dependent RNA polymerase catalyses the polymerisation in only one direction, that is, $5' \rightarrow 3'$. The strand that has the polarity $3' \rightarrow 5'$ acts as a template, and is referred to as the template strand.

The RNA transcript is complementary to the DNA template strand with Adenine ($A$) pairing with Uracil ($U$), and Cytosine ($C$) pairing with Guanine ($G$): $$\text{DNA Template:}\quad 3'\;\text{TACATGGCAAATATCCATTCA}\;5'$$ $$\text{RNA Transcript:}\quad 5'\;\text{AUGUACCGUUUAUAGGUAAGU}\;3'$$

Option (2) contains Thymine ($T$), which cannot exist in an RNA transcript. Option (1) has incorrect terminal bases. Option (3) is exact.